Everything below concerns research chemical. We keep the language plain, cite what the science says, and separate well-supported claims from open questions.
Updated 2026-08-01. Numbers and descriptions here follow the published literature rather than marketing material.
Controlled human trials of the short fragment are scarce. Much of what appears in review articles is extrapolated from animal models or from studies of the parent protein, and literature searches return a larger body of cardiac and ophthalmic work on thymosin beta-4 than on the abbreviated peptide. Regulatory treatment differs by jurisdiction, and in several countries the material is handled as a research chemical rather than an approved therapeutic. Statements about human benefit should be read as provisional.
Biological interest in this peptide centers on its relationship to actin dynamics. Thymosin beta-4 binds monomeric actin through an LKKTET motif, and a short sequence carrying that motif can compete with other actin-binding proteins in cell-free preparations. Investigators propose that such competition shifts the balance between filament assembly and disassembly, which in turn affects how readily a cell extends protrusions and migrates. Most of the supporting observations come from cultured cells and purified protein systems rather than from intact organisms.
Animal work has examined the peptide in models of cardiac injury, skin wounding, and corneal repair, with reported outcomes covering cell migration, inflammatory cell influx, and tissue remodeling. Several of those experiments used the full-length protein or longer fragments instead of the seven-residue sequence, which makes direct comparison between reports difficult. Results are generally described as tissue-dependent, and effect sizes vary considerably across laboratories. Independent replication is uneven, so the overall picture is incomplete rather than settled.
The compound circulates in the literature as a research reagent rather than an approved therapeutic. Regulatory agencies in several countries have not authorized it for medical use, and sporting bodies list related thymosin beta-4 peptides among prohibited substances. Suppliers typically market it with a purity figure and a certificate of analysis, while peer-reviewed clinical reports remain sparse. Discussions therefore often separate laboratory findings from anecdotal reports, and reviewers tend to note the small size and methodological limits of the available studies.
TB-500 refers to a synthetic peptide fragment derived from the actin-binding region of thymosin beta-4, a protein present in most mammalian cells. The full protein contains forty-three amino acids, while the commonly sold fragment is a much shorter acetylated sequence, often cited as LKKTETQ. The fragment retains part of the actin-binding motif but lacks the remainder of the parent protein. Material sold under this name is usually lyophilized powder intended for laboratory research, and it is not a finished pharmaceutical product.
Proposed activity centers on actin sequestration and on the movement of cells during repair processes. In cell culture and animal models, the fragment has been associated with migration, tube formation, and tissue remodeling. These observations are frequently described as preliminary, because most published work uses rodent or in vitro systems rather than controlled human trials. Whether the short fragment reproduces the effects of the full protein remains an open question, and the relationship between dose, route, and measured outcome is not well characterized.
| Property | Value | Notes |
|---|---|---|
| Common synonyms | Thymosin beta-4 fragment; TB4 fragment | Naming is inconsistent across suppliers and publications |
| Reported sequence | Ac-LKKTETQ | Corresponds to residues 17-23 of the parent protein |
| Frequently cited registry number | 77591-33-4 | Associated with full-length thymosin beta-4 rather than the fragment |
| Common supplied form | Freeze-dried solid | Often presented as an acetate or trifluoroacetate salt |
| Regulatory treatment | Varies by country | Frequently handled as a research chemical; not broadly approved as a therapeutic |
Reconstitution practices affect downstream measurements. The dry powder is typically dissolved in sterile water or a suitable aqueous buffer, then mixed gently rather than vortexed at high speed. Visible particles or cloudiness suggest incomplete dissolution or contamination and should be investigated. For long-term storage, aliquots should be labeled with concentration, solvent, and date. Open questions include how different buffers alter peptide conformation and whether specific container materials adsorb the peptide. Those variables can change apparent concentration in assays even when the chemical identity is correct.
Lyophilized TB-500 is hygroscopic and should be kept dry before use. The usual storage recommendation for the solid is -20 °C, protected from light and moisture. Once dissolved, the peptide is less stable, and repeated freeze-thaw cycles can promote aggregation or degradation. Laboratories often divide a reconstituted solution into single-use aliquots and store them at -80 °C. Exact stability limits depend on buffer, pH, and concentration, so published data do not define a single universal condition.
Identity and purity are checked with chromatographic and mass spectrometric methods. Reverse-phase high-performance liquid chromatography separates the peptide from related impurities, while mass spectrometry confirms the expected molecular mass. A certificate of analysis may report a purity percentage, but the laboratory should still verify the material independently. Common quality concerns include truncated sequences, deamidation, oxidation, and residual solvents from synthesis. Because TB-500 is short, some impurities can differ from the target by only a few mass units.
Interest in the fragment grew during the 1990s and 2000s, when it moved from laboratory work into sports and supplement markets. Anti-doping bodies added thymosin beta-4 fragments to prohibited lists, and a small number of adverse analytical findings have been reported in competition testing. Published controlled human trials remain scarce. Most mechanistic evidence comes from cell culture and animal models, and those studies examine endpoints such as cell migration, wound closure and inflammation markers. That evidence supports research interest but does not establish clinical benefit, and broad regenerative claims should be read as unverified.
TB-500 is a short synthetic peptide sold under a trade name rather than a systematic chemical name. Suppliers usually describe it as a fragment of thymosin beta-4 and ship it as a lyophilised powder intended for laboratory use. Because the label is commercial, the exact sequence attributed to it is not fully consistent across catalogues, and some listings present a seven-residue peptide while others describe related fragments of similar length. It is not an approved medicine in any major jurisdiction, and it is handled as a research chemical.
Thymosin beta-4 itself is a natural peptide of 43 residues found in many cell types and body fluids. Its best-characterised function is binding and sequestering actin monomers, which influences cytoskeletal dynamics. The sequence most often associated with TB-500, LKKTETQ, corresponds to part of that actin-binding region. A different fragment, Ac-SDKP, is also derived from the same parent peptide and is studied in its own right, which is one reason discussions of thymosin fragments can become confusing. The two are structurally distinct and are not interchangeable.
Dry peptide powder is commonly kept at −20 °C in a desiccated container away from light, a practice that limits moisture uptake and oxidation. Once dissolved, solutions are generally held at 2–8 °C for short periods or frozen at −20 °C or lower for longer storage, with repeated freeze-thaw cycles avoided. Hydrolysis and oxidation are the main degradation routes for peptides in solution, and both accelerate at higher temperature or extreme pH. Published stability data specific to TB-500 are limited, so shelf life should be treated as uncertain.
Identity and purity checks for peptide material typically combine reversed-phase high-performance liquid chromatography with mass measurement, since retention time alone cannot confirm a sequence. Mass measurement verifies the expected molecular mass within instrument tolerance, while chromatographic peak area provides a purity estimate. Anti-doping analysis of urine uses related but more sensitive workflows, sometimes after solid-phase extraction. For research material, batch documentation, certificate content, and independent testing are common points of scrutiny, because supply chains outside pharmaceutical regulation vary widely in the paperwork they provide.
Reconstitution of a lyophilized peptide is normally done with sterile water or a suitable buffer under aseptic conditions. Adding solvent down the vial wall and allowing gentle dissolution instead of vigorous vortexing reduces the chance of aggregation, which can lower the effective concentration of the resulting solution. Concentrated stocks are usually diluted into working buffer shortly before use. Because no standard preparation protocol exists for TB-500 specifically, laboratories adapt general peptide handling practice, and reported results may reflect differing preparation choices.
Identity and purity are checked with reversed-phase high-performance liquid chromatography, which separates the target sequence from truncated or deletion analogues, and with mass spectrometry, which confirms the expected molecular mass. Amino acid analysis and peptide mapping give orthogonal confirmation but are used less often outside specialist laboratories. Counter-ion content varies: material purified on trifluoroacetic acid gradients retains trifluoroacetate, and ion exchange can convert the salt form. Residual water and solvent are measured by Karl Fischer titration or thermogravimetric analysis, and any purity figure should be read together with the method used to obtain it.
Lyophilised peptide powders are hygroscopic, and the fragment absorbs atmospheric moisture when a vial is opened at room temperature. Weighing and aliquoting are normally done quickly in a dry environment, and stock solutions are divided into single-use portions before freezing. Repeated freeze-thaw cycles are avoided because they promote aggregation and can shift the measured content of a vial. These practices are general to synthetic peptides rather than unique to this sequence, but they matter more for short chains kept for long periods.
Pyrrole-2-carboxylate monooxygenase (EC 1.14.13.130, pyrrole-2-carboxylate oxygenase) is an enzyme with systematic name pyrrole-2-carboxylate,NADH:oxygen oxidoreductase (5-hydroxylating). This enzyme catalyses the following chemical reaction
Escherichia coli: 0.12–128 μg/mL Klebsiella pneumoniae: 0.25–128 μg/mL Pseudomonas aeruginosa: ≤0.06–16 μg/mL For example, colistin in combination with other drugs is used to attack P. aeruginosa biofilm infection in lungs of patients with cystic fibrosis. Biofilms have a low-oxygen environment below the surface where bacteria are metabolically inactive, and colistin is highly effective in this environment. However, P. aeruginosa reside in the top layers of the biofilm, where they remain metabolically active. This is because surviving tolerant cells migrate to the top of the biofilm via pili and form new aggregates via quorum sensing.
=== Regier et al. (2005) === In a 2005 study of nuclear genomes Regier et al. suggest that Hexapoda is most closely related to Branchiopoda and Cephalocarida + Remipedia, thereby hexapods are "terrestrial crustaceans", thus supporting the Pancrustacea hypothesis that maxillopods are not monophyletic (in the following cladograms Maxillopoda subclasses are highlighted). In addition, there appeared some evidence against the Ostracoda monophyly: that Ostracoda subclass Podocopa may form a clade with Branchiura.
Cited half-life: the median age of the articles that were cited in Journal Citation Reports each year. For example, if a journal's half-life in 2005 is 5, that means the citations from 2001 to 2005 are half of all the citations from that journal in 2005, and the other half of the citations precede 2001. Aggregate impact factor for a subject category: it is calculated taking into account the number of citations to all journals in the subject category and the number of articles from all the journals in the subject category. Immediacy index: the number of citations the articles in a journal receive in a given year divided by the number of articles published. Journal citation indicator (JCI): a JIF that adjusts for scientific field; it is similar to Source Normalized Impact per Paper, calculated based on the Scopus database. JCI is available for all journals in the Web of Science Core Collection (WoS CC)—including the AHCI, ESCI, BCI, CPCI—while JIF is only available for the SCIE and SSCI; however, starting in June 2023, JIF will also be issued for all journals in the WoS CC. JIF quartile ranking: a rank based on the four quartiles within a given subject or topic category. JIF percentile ranking: a percentile rank computed for a particular subject category. A given journal may attain a different quartile or percentile in different categories. As with the impact factor, there are some nuances to this: for example, Clarivate excludes certain article types (such as news items, correspondence, and errata) from the denominator.
== Biochemistry == PCT is a member of the calcitonin (CT) superfamily of peptides. It is a peptide of 116 amino acids with an approximate molecular weight of 14.5 kDa, and its structure can be divided into three sections (see Figure 1): amino terminus (represented by the ball and stick model in Figure 1), immature calcitonin (shown in Figure 1 from PDB as the crystal structure of procalcitonin is not yet available), and calcitonin carboxyl-terminus peptide 1. Under normal physiological conditions, active CT is produced and secreted in the C-cells of the thyroid gland after proteolytic cleavage of PCT, meaning, in a healthy individual, that PCT levels in circulation are very low (<.05 ng/mL). The pathway for production of PCT under normal and inflammatory conditions are shown in Figure 2. During inflammation, LPS, microbial toxin, and inflammatory mediators, such as IL-6 or TNF-α, induce the CALC-1 gene in adipocytes, but PCT never gets cleaved to produce CT. In a healthy individual, PCT in endocrine cells is produced by CALC-1 by elevated calcium levels, glucocorticoids, CGRP, glucagon, or gastrin, and is cleaved to form CT, which is released to the blood. PCT is located on the CALC-1 gene on chromosome 11. Bacterial infections induce a universal increase in the CALC-1 gene expression and a release of PCT (>1 μg/mL). Expression of this hormone occurs in a site specific manner. In healthy and non-infected individuals, transcription of PCT only occurs in neuroendocrine tissue, except for the C cells in the thyroid.
Sources: en.wikipedia.org
On 12 June 1944 U.S. carriers made air strikes on the Marianas, convincing Admiral Soemu Toyoda that the U.S. was preparing to invade. This move came as a surprise; the Japanese had expected the next U.S. target to be further south, either at the Carolines or the Palaus, and had protected the Marianas with only 50 land-based aircraft. On 13–15 June, American carriers made additional airstrikes while surface forces bombarded the Marianas. On 15 June, the first American troops went ashore on Saipan. Since control of the Marianas would bring American strategic bombers within range of the Japanese home islands, the IJN decided it was time for the long-awaited Kantai Kessen (decisive battle). Toyoda immediately ordered a fleet-based counterattack, committing nearly all of the Japanese navy's serviceable ships. The main portions of the fleet rendezvoused on 16 June in the western part of the Philippine Sea and completed refueling on 17 June. Admiral Jisaburō Ozawa commanded this force from his newly commissioned flagship, Taihō. In addition to extensive command facilities, reinforced torpedo blisters and a large air group, Taihō was the first Japanese carrier with an armor-plated flight deck, designed to withstand bomb hits with minimal damage. At 18:35 on 15 June the submarine USS Flying Fish sighted a Japanese carrier and battleship force coming out of the San Bernardino Strait. An hour later USS Seahorse spotted a battleship and cruiser force steaming up from the south, 200 miles (320 km) east of Mindanao.
== Early life and education == Born in Preston, Lancashire in 1949, Halliwell was educated at Preston Grammar School. He attended St Catherine's College, University of Oxford (1968–71), achieving a BA with First Class (honours) in biochemistry. He was also awarded the Rose Prize for the best final papers of any candidate in biological sciences. His D.Phil in plant biochemistry was also at Oxford, supervised by Frederick R. Whatley and Vernon Butt; his thesis was entitled "The biochemistry of plant peroxisomes" (1973). He was later awarded a D.Sc from the University of London for his work on the biochemistry of free radical reactions in plant and animal systems.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
https://web.archive.org/web/20070405211049/http://www.dentistry.leeds.ac.uk/biochem/MBWeb/mb1/part2/krebs.htm#animat1 - animation of the general mechanism of the PDC (link on upper right) at University of Leeds Pyruvate+Dehydrogenase+Complex at the U.S. National Library of Medicine Medical Subject Headings (MeSH)
== Characteristics == The genome of C. xerosis is approximately 2.7 million base pairs long with over 2,000 genes encoding proteins and a high G+C content. C. xerosis was found to contain a series of plasmids, one of which confers resistance to common antibiotics such as chloramphenicol, kanamycin, streptomycin, and tetracycline and was named pTP10. This plasmid has since been introduced into Bacillus subtilis and modified to generate several vectors for molecular cloning purposes. In addition to having resistance to many antibiotics itself, at least one strain of C. xerosis also appears capable of producing antimicrobial compounds. These can inhibit bacteria and fungi, but the strength of antimicrobial activity by this strain depends on the carbon sources available. Also, a petroleum ether extract from C. xerosis was found to decrease the growth rate of tumors in mice, increasing their lifespan while being nontoxic to healthy mice. A study in 1967 confirmed the ability of several strains of C. xerosis to form single-layer "clumps" of cells around gas bubbles when cultures of the bacteria are suspended in buffer solutions at low temperatures with vigorous stirring. This property was attributed to cell surface proteins.
Sources: en.wikipedia.org
=== Lipids === Source: The lipid tail is essential for enabling lipid membrane insertion and retention but also for giving the construct amphiphilic characteristics that enable hydrophilic surface coating (due to formation of bilipid layers). Different membrane lipids that can be used to create FSLs have different membrane physiochemical characteristics and thus can affect biological function of the FSL. Lipids in FSL Kode constructs include:
== Contraindications == Plecanatide has not been shown to be safe or effective in persons 6 years to 18 years of age. Use of plecanatide by persons under the age of 6 poses a serious dehydration risk and studies have demonstrated plecanatide can cause death in juvenile mice due to this dehydrating effect. Use of plecanatide is also contraindicated in persons who are suspected of having a mechanical gastrointestinal obstruction.
Writer G. Pascal Zachary argues in a Wired essay that legalizing performance-enhancing substances, as well as genetic enhancements once they became available, would satisfy society's need for übermenschen and reverse the decline in public interest in sports. Sports scholar Verner Moller argues that society is hypocritical when it holds athletes to moral standards, but do not conform to those morals themselves. Fox Sports writer Jen Floyd Engel stated in an article, "We live in a pharmacological society. We live in a society of short cuts, of fake this and enhanced that, and somehow we keep trying to sell the line that sports has become this evil empire of cheating. The reality is athletes are merely doing what so many of us do and celebrate and watch every single day of our lives." Sociologist Ellis Cashmore argues that what is considered doping is too arbitrary: transfusing blood cells is not allowed, but other methods of boosting blood cell count, such as hypobaric chambers, are allowed. Other scholars have advanced similar arguments. In 2023, Australian businessman Aron D'Souza announced the Enhanced Games, a sports event permitting doping. British academic Byron Hyde criticized the Games for coercing retired athletes on low salaries into participating with large financial incentives, but observed that many other sports also coerce athletes into harming themselves for fame or money, including the Olympics. He observed that athletes increasingly face an "enhance or retire" dynamic.
These processes result in horizontal gene transfer, transmitting fragments of genetic information between organisms that would be otherwise unrelated. Natural bacterial transformation occurs in many bacterial species, and can be regarded as a sexual process for transferring DNA from one cell to another cell (usually of the same species). Transformation requires the action of numerous bacterial gene products, and its primary adaptive function appears to be repair of DNA damages in the recipient cell.
In 1913, as part of his exploration into the composition of canal rays, J. J. Thomson channeled a stream of ionized neon through a magnetic and an electric field and measured its deflection by placing a photographic plate in its path. Thomson observed two patches of light on the photographic plate (see image on left), which suggested two different parabolas of deflection. Thomson concluded that the neon gas was composed of atoms of two different atomic masses (neon-20 and neon-22). Thomson's student Francis William Aston continued the research at the Cavendish Laboratory in Cambridge, building the first full functional mass spectrometer that was reported in 1919. He was able to identify isotopes of chlorine (35 and 37), bromine (79 and 81), and krypton (78, 80, 82, 83, 84 and 86), proving that these natural occurring elements are composed of a combination of isotopes. The use of electromagnetic focusing in mass spectrograph which rapidly allowed him to identify no fewer than 212 of the 287 naturally occurring isotopes. In 1921, F. W. Aston became a fellow of the Royal Society and received a Nobel Prize in Chemistry in the following year. His work on isotopes also led to his formulation of the Whole Number Rule which states that "the mass of the oxygen isotope being defined [as 16], all the other isotopes have masses that are very nearly whole numbers," a rule that was used extensively in the development of nuclear energy.
Sources: en.wikipedia.org
The leading proposal involves sequestration of monomeric actin, which would alter cytoskeletal turnover and cell movement. The actin-binding motif shared with the parent protein is central to that idea. Direct confirmation in whole organisms remains limited.
Very few controlled human studies focus on the seven-residue sequence itself. Most clinical data concern the full-length protein in cardiac or ophthalmic settings. Conclusions drawn for one form should not be assumed to transfer to the other.
Detection normally relies on reversed-phase liquid chromatography paired with mass spectrometry. Chromatographic retention time establishes the expected elution window, and the mass spectrum confirms the molecular ion. Immunoassays exist but can cross-react with related peptides.
TB-500 is a name used for a short synthetic peptide fragment taken from the actin-binding region of thymosin beta-4. Material sold under this label is usually a lyophilized powder supplied for laboratory research rather than a licensed medicine. The commonly cited sequence is LKKTETQ.